SubtiBank SubtiBank
epsC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

epsC

UDP-N-acetylglucosamine 4,6-dehydratase, required for extracellular polysaccharide synthesis, this gene is inactive in B. subtilis 168
locus
BSU34350
pI
8.77
mw
66.09 kDa
protein length
598 aa Sequence Blast
gene length
1797 bp Sequence Blast
function
[category|SW 4.1.2|Biofilm formation], biosynthesis of N,N'-diacetylbacillosamine
product
UDP-N-acetylglucosamine 4,6-dehydratase
essential
no
synonyms
yveM

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,526,407 3,528,203

    The protein

    Protein family

  • [SW|Polysaccharide synthase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F42B27D5D7F3F39828940E377ABCC0730B25EA88|YodU]:
  • [protein|240CD6EA3793821F5109252BDEF69C0120E454EF|YpqP]:
  • [SW|Cofactors]

  • NAD+ [pubmed|30222950]
  • Structure

  • [PDB|5BJW] (from Campylobacter jejuni, corresponds to the C-terminal part of EpsC, aa 242 ... 571, 47% identity) [pubmed|29053280]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A071 (yveM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/71 NBRP B. subtilis, Japan]
  • BKE34350 ([gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGTCTTCTCCGGT, downstream forward: _UP4_AGCGTTCATTAGGGGGAGTG
  • BKK34350 ([gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGTCTTCTCCGGT, downstream forward: _UP4_AGCGTTCATTAGGGGGAGTG
  • References

    Reviews

  • 20384681,20735481
  • Research papers

  • 27655338,30222950,29053280
  • The EAR [SW|RNA switch]

  • 20374491,20230605
  • Labs working on this gene/protein

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]