SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


22.82 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,392,751 2,393,350

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,8759874], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190,8759874]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-A421 (yphA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22860 ([gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACTTCCTCCATATT, downstream forward: _UP4_AACAAAGGAGCTACCAAAAT
  • BKK22860 ([gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACTTCCTCCATATT, downstream forward: _UP4_AACAAAGGAGCTACCAAAAT
  • References

  • 15699190,8759874