SubtiBank SubtiBank
yphA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yphA

unknown
locus
BSU_22860
pI
9.25
mw
22.82 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,392,751 2,393,350

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]-[gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]
    description
    [Pubmed|15699190,8759874]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,8759874], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190,8759874]
  • view in new tab

    genes
    [gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]-[gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]-[gene|910109496E4A41EC892996DEEB81971FCBD9CB05|ypzH]-[gene|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|yphC]-[gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A421 (yphA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/421 NBRP B. subtilis, Japan]
  • BKE22860 ([gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACTTCCTCCATATT, downstream forward: _UP4_AACAAAGGAGCTACCAAAAT
  • BKK22860 ([gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTACTTCCTCCATATT, downstream forward: _UP4_AACAAAGGAGCTACCAAAAT
  • References

  • 15699190,8759874