SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to carbonic anhydrase
19.36 kDa
protein length
175 aa Sequence Blast
gene length
528 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    209,633 210,160

    The protein

    Protein family

  • beta-class carbonic anhydrase family (with [protein|E00889289B07BE78CC0C8E0962A55C3B14871E00|YvdA] and [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB], according to UniProt)
  • Paralogous protein(s)

  • [protein|E00889289B07BE78CC0C8E0962A55C3B14871E00|YvdA]: (29.4%)
  • [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB]: (32%)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE01860 ([gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACACCTCTTCCT, downstream forward: _UP4_TGATGAAATGCAGGTTTAAC
  • BKK01860 ([gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACACCTCTTCCT, downstream forward: _UP4_TGATGAAATGCAGGTTTAAC