SubtiBank SubtiBank
ybcF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybcF

similar to carbonic anhydrase
locus
BSU_01860
pI
4.91
mw
19.36 kDa
protein length
175 aa Sequence Blast
gene length
528 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    209,633 210,160

    The protein

    Protein family

  • beta-class carbonic anhydrase family (with [protein|E00889289B07BE78CC0C8E0962A55C3B14871E00|YvdA] and [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB], according to UniProt)
  • Paralogous protein(s)

  • [protein|E00889289B07BE78CC0C8E0962A55C3B14871E00|YvdA]: (29.4%)
  • [protein|F942C0F4618FACEF35ACA629355BAC288556E7B6|YtiB]: (32%)
  • Expression and Regulation

    Operons

    genes
    [gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE01860 ([gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACACCTCTTCCT, downstream forward: _UP4_TGATGAAATGCAGGTTTAAC
  • BKK01860 ([gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCACACCTCTTCCT, downstream forward: _UP4_TGATGAAATGCAGGTTTAAC