SubtiBank SubtiBank
sspN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sspN

small acid-soluble spore protein (minor)
locus
BSU18020
pI
10.44
mw
5.22 kDa
protein length
gene length
147 bp Sequence Blast
function
protection of spore DNA
product
small acid-soluble spore protein (minor)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.3|Small acid-soluble spore proteins]
  • Gene

    Coordinates
    1,930,264 1,930,410

    The protein

    Protein family

  • sspN family (according to Swiss-Prot)
  • [SW|Localization]

  • spore core (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5D79D9D38B588FE0EC688D54FE68E6F49238DA46|sspN]-[gene|DE52E15D900F9665E35D2C8138DA3ABFC2B7B723|tlp]
    description
    [Pubmed|10333516]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,10333516], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|15699190,10333516]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE18020 ([gene|5D79D9D38B588FE0EC688D54FE68E6F49238DA46|sspN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCCTCAAC, downstream forward: _UP4_TAGCGAAAATTCGAGTTTAT
  • BKK18020 ([gene|5D79D9D38B588FE0EC688D54FE68E6F49238DA46|sspN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCTCCTCAAC, downstream forward: _UP4_TAGCGAAAATTCGAGTTTAT
  • References

  • 16497325,10333516,30782632