SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


inhibitor of motility and glycosyltransferase required for EPS biosynthesis
32.05 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
biofilm formation
glycosyltransferase, inhibitor of motility

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    3,524,417 3,525,253

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Catalyzed reaction/ biological activity

  • arrests flagellar rotation in a manner similar to that of a clutch, by disengaging motor force-generating elements in cells embedded in the biofilm matrix, separates the cytoplasmic [protein|8DDCC3D139ACCB635BF014946E1282A72D535390|FliG] motor from the [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|MotB] stator [Pubmed|18566286]
  • biosynthesis of extracellular polysaccharides [Pubmed|21170308]
  • Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Modification

  • phosphorylated by [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB] on a Tyr residue [Pubmed|25085422]
  • [SW|Localization]

  • cell membrane, forms spots at flagellar basal bodies [Pubmed|18566286]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials


  • MGNA-B613 (yveO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34330 ([gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT, downstream forward: _UP4_AAGCATGAATAGCAGCCAAA
  • BKK34330 ([gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATACGCTTTTCTCCTT, downstream forward: _UP4_AAGCATGAATAGCAGCCAAA
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [ homepage]
  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481,24988880,25251856,31136265
  • Research papers

  • 18566286,25085422,21170308,22113911
  • The EAR [SW|RNA switch]

  • 20374491,20230605