SubtiBank SubtiBank
yetA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yetA

similar to exo-rhamnogalacturonan lyase
locus
BSU_07090
pI
6.09
mw
97.39 kDa
protein length
857 aa Sequence Blast
gene length
2574 bp Sequence Blast
function
utilization of rhamnogalacturonan
product
putative exo-rhamnogalacturonan lyase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    776,834 779,407

    The protein

    Structure

  • [PDB|5XQG] (from Penicillium chrysogenum, 33% identity) [pubmed|29574769]
  • Biological materials

    Mutant

  • MGNA-B456 (yetA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1455 NBRP B. subtilis, Japan]
  • BKE07090 ([gene|5D709A74B628A23B3727BF1657168DB3E338AE49|yetA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCTCTCCCTCCATA, downstream forward: _UP4_TAACAGCCGGAATTTCATAG
  • BKK07090 ([gene|5D709A74B628A23B3727BF1657168DB3E338AE49|yetA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCTCTCCCTCCATA, downstream forward: _UP4_TAACAGCCGGAATTTCATAG
  • References

    Research papers

  • 29574769