SubtiBank SubtiBank
ypbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypbD

unknown
locus
BSU_23010
pI
7.40
mw
21.84 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,406,293 2,406,862

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A422 (ypbD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/422 NBRP B. subtilis, Japan]
  • BKE23010 ([gene|5D6425C766868E69E28EA3C5C01FCA0960955716|ypbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACTGCTTCAGCA, downstream forward: _UP4_TTTGAACATGTGAGGAGGGA
  • BKK23010 ([gene|5D6425C766868E69E28EA3C5C01FCA0960955716|ypbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACTGCTTCAGCA, downstream forward: _UP4_TTTGAACATGTGAGGAGGGA