SubtiBank SubtiBank
swrA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

swrA

master activator of flagellar biosynthesis, modulator of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity, converts [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P from a repressor to an activator of the fla-che operon, enhances [gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD] transcription, controls the number of flagellar basal bodies, inactive pseudogene in strain 168
locus
BSU_35230
pI
0.00
mw
0.00 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity
product
swarming motility protein
essential
no
synonyms
swrAA/1,swrAA,yvzD,ifm

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,621,618 3,621,956

    Phenotypes of a mutant

  • loss of swarming motility [Pubmed|12864845]
  • The protein

    Catalyzed reaction/ biological activity

  • interacts with the N-terminal domain of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] to control the activity of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|22496484]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]-[gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • SwrA levels are 3 ... 10-fold increased on solid medium as compared to liquid medium (due to [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]/[protein|A6E7212D159F076F5D26F9C02F340B40C3667623|SmiA]-mediated degradation of SwrA in liquid medium) [PubMed|25538299]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A376 (yvzD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/376 NBRP B. subtilis, Japan]
  • BKE35230 ([gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCTTTTAATTGTTCCA, downstream forward: _UP4_TAAACTCTCCTGAGGATATC
  • BKK35230 ([gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCTTTTAATTGTTCCA, downstream forward: _UP4_TAAACTCTCCTGAGGATATC
  • References

    Reviews

  • 20735481,22092493
  • Original publications

  • 16091050,22773650,16357223,19389763,16030230,18567663,15066026,22496484,19389763,19749039,21278284,21602220,22329926,23190039,24386445,12864845,25538299,25843804,29311275,30263953