SubtiBank SubtiBank
swrA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

swrA

master activator of flagellar biosynthesis, modulator of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity, converts [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P from a repressor to an activator of the fla-che operon, enhances [gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD] transcription, controls the number of flagellar basal bodies, inactive pseudogene in strain 168
locus
BSU_35230
pI
0.00
mw
0.00 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] activity
product
swarming motility protein
essential
no
synonyms
swrAA/1,swrAA,yvzD,ifm

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,621,618 3,621,956

    Phenotypes of a mutant

  • loss of swarming motility [Pubmed|12864845]
  • The protein

    Catalyzed reaction/ biological activity

  • interacts with the N-terminal domain of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] to control the activity of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|22496484]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]-[gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|18567663], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18567663], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA] promoter) [Pubmed|18567663], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • SwrA levels are 3 ... 10-fold increased on solid medium as compared to liquid medium (due to [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]/[protein|A6E7212D159F076F5D26F9C02F340B40C3667623|SmiA]-mediated degradation of SwrA in liquid medium) [PubMed|25538299]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A376 (yvzD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/376 NBRP B. subtilis, Japan]
  • BKE35230 ([gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCTTTTAATTGTTCCA, downstream forward: _UP4_TAAACTCTCCTGAGGATATC
  • BKK35230 ([gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCTTTTAATTGTTCCA, downstream forward: _UP4_TAAACTCTCCTGAGGATATC
  • References

    Reviews

  • 20735481,22092493
  • Original publications

  • 16091050,22773650,16357223,19389763,16030230,18567663,15066026,22496484,19389763,19749039,21278284,21602220,22329926,23190039,24386445,12864845,25538299,25843804,29311275,30263953,31769462