SubtiBank SubtiBank
ybfG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfG

putative pepdidoglycan binding protein
locus
BSU_02200
pI
4.69
mw
79.05 kDa
protein length
732 aa Sequence Blast
gene length
2199 bp Sequence Blast
function
unknown
product
putative pepdidoglycan binding protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    239,644 241,842

    The protein

    Protein family

  • fadG family (with [protein|0264C72F95D53F0211B52753DA37B4A8C0E982D2|FadG], according to UniProt)
  • Paralogous protein(s)

  • [protein|0264C72F95D53F0211B52753DA37B4A8C0E982D2|FadG]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]-[gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF]-[gene|3E2A864B904DE4D9F72D2B19257AE81CCED3BE12|ybfE]
    description
    [Pubmed|22383849]

    regulation

  • the mRNA is processed between [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG] and [gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B968 (ybfG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1967 NBRP B. subtilis, Japan]
  • BKE02200 ([gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGATTCCTCCTTTGT, downstream forward: _UP4_TAACTTTAATACAAAACTGC
  • BKK02200 ([gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGATTCCTCCTTTGT, downstream forward: _UP4_TAACTTTAATACAAAACTGC
  • References

    Research papers

  • 29794222