SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative pepdidoglycan binding protein
79.05 kDa
protein length
732 aa Sequence Blast
gene length
2199 bp Sequence Blast
putative pepdidoglycan binding protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    239,644 241,842

    The protein

    Protein family

  • fadG family (with [protein|0264C72F95D53F0211B52753DA37B4A8C0E982D2|FadG], according to UniProt)
  • Paralogous protein(s)

  • [protein|0264C72F95D53F0211B52753DA37B4A8C0E982D2|FadG]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • the mRNA is processed between [gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG] and [gene|CEA0A2CE520B8A6E8E9D7C079B954B24137DF686|ybfF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B968 (ybfG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02200 ([gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGATTCCTCCTTTGT, downstream forward: _UP4_TAACTTTAATACAAAACTGC
  • BKK02200 ([gene|5D159F09BFD98B58A7EDAD37A4DB6468A702D09A|ybfG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGATTCCTCCTTTGT, downstream forward: _UP4_TAACTTTAATACAAAACTGC
  • References

    Research papers

  • 29794222