SubtiBank SubtiBank
pyrF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrF

orotidine 5-phosphate decarboxylase
locus
BSU_15550
pI
5.84
mw
25.84 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
function
pyrimidine biosynthesis
product
orotidine-5-phosphate decarboxylase
essential
no
ec
4.1.1.23
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    Coordinates
    1,628,622 1,629,341

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • H+ + orotidine 5'-phosphate --> CO2 + UMP (according to UniProt)
  • Protein family

  • OMP decarboxylase family (single member, according to UniProt)
  • Structure

  • [PDB|1DBT]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15550 ([gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGTGTTTCTTCAGCTGACG, downstream forward: _UP4_GCCTATAAGGCTGTCAGACT
  • BKK15550 ([gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGTGTTTCTTCAGCTGACG, downstream forward: _UP4_GCCTATAAGGCTGTCAGACT
  • References

  • 8206849,1709162,25326311,28189581