SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


regulation of anaerobic genes
17.99 kDa
protein length
158 aa Sequence Blast
gene length
474 bp Sequence Blast
regulation of anaerobic genes

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,830,141 → 3,830,617

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11698370], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|Fnr]) [,16428414 PubMed]
  • view in new tab

    Biological materials


  • MGNA-B663 (ywiD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37290 (Δ[gene|5D09E5276E3E6D008EFE4B02E4EA7DE1A33ADAE6|arfM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAAACCTCCTGTGC, downstream forward: _UP4_TAAATAGAGCCGGTTTTTTT
  • BKK37290 (Δ[gene|5D09E5276E3E6D008EFE4B02E4EA7DE1A33ADAE6|arfM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAAACCTCCTGTGC, downstream forward: _UP4_TAAATAGAGCCGGTTTTTTT
  • References

  • 11698370,8846791,16428414