SubtiBank SubtiBank
arfM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

arfM

regulation of anaerobic genes
locus
BSU37290
pI
5.84
mw
17.99 kDa
protein length
158 aa Sequence Blast
gene length
474 bp Sequence Blast
function
regulation of anaerobic genes
product
unknown
essential
no
synonyms
ywiD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,830,141 → 3,830,617

    Expression and Regulation

    Operons

    genes
    [gene|5D09E5276E3E6D008EFE4B02E4EA7DE1A33ADAE6|arfM]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11698370], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|Fnr]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8846791,16428414 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B663 (ywiD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1662 NBRP B. subtilis, Japan]
  • BKE37290 (Δ[gene|5D09E5276E3E6D008EFE4B02E4EA7DE1A33ADAE6|arfM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAAACCTCCTGTGC, downstream forward: _UP4_TAAATAGAGCCGGTTTTTTT
  • BKK37290 (Δ[gene|5D09E5276E3E6D008EFE4B02E4EA7DE1A33ADAE6|arfM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAAACCTCCTGTGC, downstream forward: _UP4_TAAATAGAGCCGGTTTTTTT
  • References

  • 11698370,8846791,16428414