SubtiBank SubtiBank
pstA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pstA

phosphate [SW|ABC transporter] (permease)
locus
BSU_24970
pI
9.30
mw
31.31 kDa
protein length
294 aa Sequence Blast
gene length
885 bp Sequence Blast
function
high-affinity phosphate uptake
product
phosphate [SW|ABC transporter] (permease)
essential
no
synonyms
yqgI,yzmD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.6|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,578,833 2,579,717

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8BC7CCE9EBD899912ED7C72CA04FE82B21516F77|PstC]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 62-280) (according to UniProt)
  • [SW|Localization]

  • membrane protein [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|BA45631351E3C9C140D15F620D7B7AC143C04932|pstS]-[gene|8BC7CCE9EBD899912ED7C72CA04FE82B21516F77|pstC]-[gene|5CE86C6768A4EF313FB5DBC270AE2A773EA58E81|pstA]-[gene|434BCED6953BE07D592AC229264C5AD0D04CBAF6|pstBA]-[gene|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|pstBB]
    description
    [Pubmed|9098050]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098050], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]-P, [PubMed|9098050,9593301], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation (5000-fold induced) ([protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]) [http://www.ncbi.nlm.nih.gov/sites/entrez/9098050,9593301 PubMed]
  • additional information

  • mRNA processing between [gene|BA45631351E3C9C140D15F620D7B7AC143C04932|pstS] and [gene|8BC7CCE9EBD899912ED7C72CA04FE82B21516F77|pstC] to maintain higher concentrations of [protein|BA45631351E3C9C140D15F620D7B7AC143C04932|PstS] relative to other components of the [SW|ABC transporter] [PubMed|15289558]
  • view in new tab

    Biological materials

    Mutant

  • BKE24970 ([gene|5CE86C6768A4EF313FB5DBC270AE2A773EA58E81|pstA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATCTGTTATTTTGCGGT, downstream forward: _UP4_TAGAACGGAAAGAGGCGAAA
  • BKK24970 ([gene|5CE86C6768A4EF313FB5DBC270AE2A773EA58E81|pstA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATCTGTTATTTTGCGGT, downstream forward: _UP4_TAGAACGGAAAGAGGCGAAA
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [http://www.uic.edu/depts/bios/faculty/hulett/hulettm.shtml Homepage]
  • References

  • 15289558,10092453,9593301,12897025,9098050,9098050,9593301