SubtiBank SubtiBank
cwlC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cwlC

N-acetylmuramoyl-L-alanine amidase
locus
BSU_17410
pI
5.94
mw
27.01 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
mother cell lysis
product
N-acetylmuramoyl-L-alanine amidase
essential
no
ec
3.5.1.28
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,872,812 1,873,579

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 3 family] (according to UniProt)
  • [SW|Domains]

  • contains an amidase_3 domain (like [protein|B09FB626274B81F00A4FB42D188E089095343182|CwlD], [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC], [protein|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|YqiI], [protein|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|YrvJ])
  • Structure

  • [PDB|1X60] (peptidoglycan binding domain) [pubmed|16042392]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|cwlC]
    description
    [Pubmed|8407798]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|8407798], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|8407798]
  • view in new tab

    Biological materials

    Mutant

  • BKE17410 ([gene|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|cwlC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATCACCTCATTA, downstream forward: _UP4_TAGCCGAGACGGGGACGAGC
  • BKK17410 ([gene|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|cwlC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCATCACCTCATTA, downstream forward: _UP4_TAGCCGAGACGGGGACGAGC
  • References

  • 10945275,16042392,11375403,8407798