SubtiBank SubtiBank
ylxW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylxW

unknown
locus
BSU_15250
pI
5.24
mw
25.88 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    1,594,492 1,595,187

    The protein

    Protein family

  • UPF0749 family (with [protein|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|YlxX], according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, (promoter within [protein|D52FDB5015B10E9B26D7FED5708457890C6EA43D|MurG]) [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8106328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    genes
    [gene|D48B7591467C493D2214D37AEA83643FE8C27BC6|murE]-[gene|4D3D4429E1F387BACB0D5A1084AA8DF179A16685|mraY]-[gene|0A9FF5A66F73464A780914A1424979CE753B3D9C|murD]-[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|1391053]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth [Pubmed|1391053]
  • view in new tab

    genes
    [gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|1391053]

    regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    genes
    [gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|8106328]
    view in new tab

    genes
    [gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|18179421]

    regulation

  • expressed during vegatative growth, then switched off, and again expressed during [SW|sporulation ]in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B361 (ylxW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1360 NBRP B. subtilis, Japan]
  • BKE15250 ([gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCAATTTTCATCTTCCTT, downstream forward: _UP4_TGACTGAAAAAGCGGGTGAA
  • BKK15250 ([gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCAATTTTCATCTTCCTT, downstream forward: _UP4_TGACTGAAAAAGCGGGTGAA
  • References

  • 1391053,8106328,8320223,18179421