SubtiBank SubtiBank
yjcG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcG

2´-CPDase
locus
BSU_11850
pI
5.57
mw
19.52 kDa
protein length
171 aa Sequence Blast
gene length
516 bp Sequence Blast
function
nucleotide metabolism
product
2´-CPDase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.4|Nucleotide metabolism/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,256,862 1,257,377

    The protein

    Catalyzed reaction/ biological activity

  • hydrolyzes a 2´,3´-cyclic nucleotide, thereby producing a nucleotide with a 3´-phosphate [pubmed|31422053]
  • Protein family

  • 2H phosphoesterase superfamily (with [protein|29A38D244A07ED0973D0846B652238524F4DBC67|YtlP], according to UniProt) [pubmed|31422053]
  • Paralogous protein(s)

  • [protein|29A38D244A07ED0973D0846B652238524F4DBC67|YtlP]
  • Structure

  • [PDB|2D4G]
  • Expression and Regulation

    Operons

    genes
    [gene|94EE92D99CA68856E6D19254B0768FFE92AF603D|yjcH]-[gene|5CA17CD28A725B8D7B87B9AAA167844042439794|yjcG]-[gene|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|yjcF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B255 (yjcG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1254 NBRP B. subtilis, Japan]
  • BKE11850 ([gene|5CA17CD28A725B8D7B87B9AAA167844042439794|yjcG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGTCCCTCCTGGA, downstream forward: _UP4_TTGCTAGGCAGAGGAGAATA
  • BKK11850 ([gene|5CA17CD28A725B8D7B87B9AAA167844042439794|yjcG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGTCCCTCCTGGA, downstream forward: _UP4_TTGCTAGGCAGAGGAGAATA
  • References

  • 12107147,18473364,16511078,31422053