SubtiBank SubtiBank
hisI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hisI

phosphoribosyl-AMP cyclohydrolase / phosphoribosyl-ATP pyrophosphohydrolase
locus
BSU34860
pI
4.63
mw
23.75 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
function
biosynthesis of histidine
product
phosphoribosyl-AMP cyclohydrolase /phosphoribosyl-ATP pyrophosphohydrolase
essential
no
ec
3.5.4.19
synonyms
hisIE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.14|Biosynthesis/ acquisition of histidine]
  • Gene

    Coordinates
    3,582,936 3,583,565

    The protein

    Catalyzed reaction/ biological activity

  • 1-(5-phosphoribosyl)-ATP + H2O = 1-(5-phosphoribosyl)-AMP + diphosphate (according to Swiss-Prot)
  • [SW|Domains]

  • N-terminal domain (aa 1 ... 116): phosphoribosyl-AMP cyclohydrolase domain (according to UniProt) [pubmed|16042384]
  • C-terminal domain (aa 117 ... 209): phosphoribosyl-ATP pyrophosphohydrolase domain (according to UniProt)
  • Structure

  • [PDB|1ZPS] (the N-terminal domain, from Methanobacterium thermoautotrophicum, 49% identity)
  • [PDB|1YVW] (the C-terminal domain, from B. cereus, 49% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]-[gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]-[gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]-[gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]-[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]-[gene|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]-[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE34860 ([gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAACGCAGTTCATCTGCCT, downstream forward: _UP4_TAAAGAGCCGGATGATACGG
  • BKK34860 ([gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAACGCAGTTCATCTGCCT, downstream forward: _UP4_TAAAGAGCCGGATGATACGG
  • References

  • 12107147,27766092,16042384