SubtiBank SubtiBank
yusV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yusV

[SW|ABC transporter] for the siderophores Fe-enterobactin and Fe-bacillibactin, as well as for the siderophores schizokinen and arthrobactin (ATPase)
locus
BSU_32940
pI
5.32
mw
30.34 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
acquisition of iron
product
[SW|ABC transporter] for the siderophores Fe-enterobactin, Fe-bacillibactin, schizokinen and arthrobactin (ATPase)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,379,112 3,379,939

    The protein

    Catalyzed reaction/ biological activity

  • ATPase for the [protein|516B13F337FD346B4A4A268E35D1EBABB05957E1|FeuA]-[protein|57402D137E3D3791CAF0696421224F4E1DC1BA48|FeuB]-[protein|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|FeuC] siderophore [SW|ABC transporter] and for the [protein|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|YfhA]-[protein|521246EDA87A00F1B5E0792EC7AF1EF2B11C1C3C|YfiY]-[protein|81494D4E7E52531802C3C0D0073739DA9375F5DF|YfiZ] siderophore [SW|ABC transporter]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|FhuC], [protein|E76640F895261DA34AD2342B54B43D11857AEA9A|FecF], [protein|473628F86C18FE9957841F3C8B45242C90CB341D|FpbP]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 6-242) (according to UniProt)
  • Structure

  • [PDB|4R9U], the ''E. coli'' BtuC-BtuD complex, BtuD shares 32% identity, 57% similarity with YusV, [Pubmed|25402482]
  • [SW|Localization]

  • associated to the membrane (via [protein|57402D137E3D3791CAF0696421224F4E1DC1BA48|FeuB]-[protein|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|FeuC] and [protein|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|YfhA]-[protein|81494D4E7E52531802C3C0D0073739DA9375F5DF|YfiZ]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]-[gene|FCA17A66EFD82BC999E3F062FB6ECCA0B413E3FB|yusU]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B599 (yusV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1598 NBRP B. subtilis, Japan]
  • BKE32940 ([gene|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT, downstream forward: _UP4_TAAATAACGCAGCGAAGGAG
  • BKK32940 ([gene|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT, downstream forward: _UP4_TAAATAACGCAGCGAAGGAG
  • References

  • 19746494,10092453,16672620,12354229,25402482