SubtiBank SubtiBank
yusV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yusV

[SW|ABC transporter] for the siderophores Fe-enterobactin and Fe-bacillibactin, as well as for the siderophores schizokinen and arthrobactin (ATPase)
locus
BSU32940
pI
5.32
mw
30.34 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
acquisition of iron
product
[SW|ABC transporter] for the siderophores Fe-enterobactin, Fe-bacillibactin, schizokinen and arthrobactin (ATPase)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,379,112 3,379,939

    The protein

    Catalyzed reaction/ biological activity

  • ATPase for the [protein|516B13F337FD346B4A4A268E35D1EBABB05957E1|FeuA]-[protein|57402D137E3D3791CAF0696421224F4E1DC1BA48|FeuB]-[protein|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|FeuC] siderophore [SW|ABC transporter] and for the [protein|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|YfhA]-[protein|521246EDA87A00F1B5E0792EC7AF1EF2B11C1C3C|YfiY]-[protein|81494D4E7E52531802C3C0D0073739DA9375F5DF|YfiZ] siderophore [SW|ABC transporter]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|FhuC], [protein|E76640F895261DA34AD2342B54B43D11857AEA9A|FecF], [protein|473628F86C18FE9957841F3C8B45242C90CB341D|FpbP]
  • Structure

  • [PDB|4R9U], the ''E. coli'' BtuC-BtuD complex, BtuD shares 32% identity, 57% similarity with YusV, [Pubmed|25402482]
  • [SW|Localization]

  • associated to the membrane (via [protein|57402D137E3D3791CAF0696421224F4E1DC1BA48|FeuB]-[protein|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|FeuC] and [protein|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|YfhA]-[protein|81494D4E7E52531802C3C0D0073739DA9375F5DF|YfiZ]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]-[gene|FCA17A66EFD82BC999E3F062FB6ECCA0B413E3FB|yusU]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B599 (yusV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1598 NBRP B. subtilis, Japan]
  • BKE32940 ([gene|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT, downstream forward: _UP4_TAAATAACGCAGCGAAGGAG
  • BKK32940 ([gene|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCGCTCCTTTTTGCT, downstream forward: _UP4_TAAATAACGCAGCGAAGGAG
  • References

  • 19746494,10092453,16672620,12354229,25402482