SubtiBank SubtiBank
ggt
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ggt

gamma-glutamyltransferase
locus
BSU_18410
pI
5.45
mw
64.01 kDa
protein length
587 aa Sequence Blast
gene length
1764 bp Sequence Blast
function
degradation of poly-glutamate capsules
product
gamma-glutamyltransferase
essential
no
ec
2.3.2.2
synonyms
pac

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,004,677 2,006,440

    The protein

    Catalyzed reaction/ biological activity

  • α-amino acid + N-terminal (5-L-glutamyl)-[peptide] --> 5-L-glutamyl amino acid + N-terminal L-α-aminoacyl-[peptide] (according to UniProt)
  • glutathione + H2O --> L-cysteinylglycine + L-glutamate (according to UniProt)
  • S-substituted glutathione + H2O --> S-substitued L-cysteinylglycine + L-glutamate (according to UniProt)
  • Protein family

  • gamma-glutamyltransferase family (with [protein|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|YwrD], according to UniProt)
  • Structure

  • [PDB|2V36]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|5C31D968E3786858B025CE02CFAC48F61700031F|ggt]
    description
    [Pubmed|22383849]

    regulation

  • strongly induced in response to glucose starvation in M9 medium [Pubmed|23033921]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • BKE18410 ([gene|5C31D968E3786858B025CE02CFAC48F61700031F|ggt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCCTCCTATATG, downstream forward: _UP4_TAAATAAAAAACTGTACTCG
  • BKK18410 ([gene|5C31D968E3786858B025CE02CFAC48F61700031F|ggt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCCTCCTATATG, downstream forward: _UP4_TAAATAAAAAACTGTACTCG
  • References

  • 27095459,15583164,12892879,18957862,20088880,22383849,23335395,23033921,21513304,21987357,24279353,24531494,24719567,29685354,30377645