SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


64.01 kDa
protein length
587 aa Sequence Blast
gene length
1764 bp Sequence Blast
degradation of poly-glutamate capsules

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,004,677 2,006,440

    The protein

    Catalyzed reaction/ biological activity

  • α-amino acid + N-terminal (5-L-glutamyl)-[peptide] --> 5-L-glutamyl amino acid + N-terminal L-α-aminoacyl-[peptide] (according to UniProt)
  • glutathione + H2O --> L-cysteinylglycine + L-glutamate (according to UniProt)
  • S-substituted glutathione + H2O --> S-substitued L-cysteinylglycine + L-glutamate (according to UniProt)
  • Protein family

  • gamma-glutamyltransferase family (with [protein|F1DF59528E340A65A982BD7E6621DDA82C10B2B5|YwrD], according to UniProt)
  • Structure

  • [PDB|2V36]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation




  • strongly induced in response to glucose starvation in M9 medium [Pubmed|23033921]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials


  • BKE18410 ([gene|5C31D968E3786858B025CE02CFAC48F61700031F|ggt]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCCTCCTATATG, downstream forward: _UP4_TAAATAAAAAACTGTACTCG
  • BKK18410 ([gene|5C31D968E3786858B025CE02CFAC48F61700031F|ggt]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCCTCCTATATG, downstream forward: _UP4_TAAATAAAAAACTGTACTCG
  • References

  • 27095459,15583164,12892879,18957862,20088880,22383849,23335395,23033921,21513304,21987357,24279353,24531494,24719567,29685354,30377645