SubtiBank SubtiBank
aroH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aroH

chorismate mutase (isozymes 1 and 2)
locus
BSU22690
pI
5.52
mw
14.38 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
chorismate mutase (isozymes 1 and 2)
essential
no
ec
5.4.99.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,377,632 2,378,015

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate = prephenate (according to Swiss-Prot)
  • Structure

  • [PDB|2CHT] (complex with a transition state analog) [pubmed|8378335]
  • [PDB|1DBF]
  • Expression and Regulation

    Operons

    genes
    [gene|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|cheR]-[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|21815947]
    view in new tab

    Biological materials

    Mutant

  • BKE22690 ([gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCCGCGAATTCCGCGAA, downstream forward: _UP4_TAATACGATAAGAACAGCTT
  • BKK22690 ([gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCCGCGAATTCCGCGAA, downstream forward: _UP4_TAATACGATAAGAACAGCTT
  • References

    Reviews

  • 12698486,9383421,12966138
  • Original publications

  • 8378335,25422475,12630863,10960481,2105742,8643526,26278727,26641683,21243152,15034619,14709097,21815947,28743924