SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


8.67 kDa
protein length
gene length
234 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,919,459 1,919,692

    Phenotypes of a mutant

  • increased sensitivity to DNA-damaging agents [Pubmed|23728628]
  • The protein

    Protein family

  • UPF0291 family (single member, according to UniProt)
  • Structure

  • [PDB|2HEP] (NMR), [PDB|3BHP]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|12581363], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|12581363]
  • additional information

  • YneA is rapidly degraded by extracellular proteases ([protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]) [PubMed|29979679,20400548]
  • view in new tab

    Biological materials


  • BKE17880 ([gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAAACTCCTTTATTG, downstream forward: _UP4_TAATATAAGAGGAATACGGC
  • BKK17880 ([gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAAACTCCTTTATTG, downstream forward: _UP4_TAATATAAGAGGAATACGGC
  • References

  • 12581363,16267290,23728628