SubtiBank SubtiBank
cadA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cadA

cadmium transporting ATPase, resistance to cadmium
locus
BSU_33490
pI
6.00
mw
75.22 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
function
cadmium export
product
cadmium transporting ATPase
essential
no
ec
3.6.3.3
synonyms
yvgW

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,438,853 3,440,952

    The protein

    Catalyzed reaction/ biological activity

  • ATP + Cd2+ + H2O --> ADP + Cd2+ + H+ + phosphate (according to UniProt)
  • ATP + H2O + Zn2+ --> ADP + H+ + phosphate + Zn2+ (according to UniProt)
  • Protein family

  • [SW|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA], [protein|017A57F27DD8E515242FB658A61E74C1D58273CC|PfeT]
  • Structure

  • [PDB|4BBJ] (CopA from ''Legionella pneumophila'', 32% identity, 67% similarity) [Pubmed|24317491]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]
    description
    [Pubmed|12779235]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12779235], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA]: repression, [Pubmed|15948947], in [regulon|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA regulon]
  • regulation

  • induced by toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|12779235,15948947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A491 (yvgW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/491 NBRP B. subtilis, Japan]
  • BKE33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT, downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
  • BKK33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT, downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 15948947,12779235,24317491,11934502,25213752