SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cadmium transporting ATPase, resistance to cadmium
75.22 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
cadmium export
cadmium transporting ATPase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,438,853 3,440,952

    The protein

    Catalyzed reaction/ biological activity

  • ATP + Cd2+ + H2O --> ADP + Cd2+ + H+ + phosphate (according to UniProt)
  • ATP + H2O + Zn2+ --> ADP + H+ + phosphate + Zn2+ (according to UniProt)
  • Protein family

  • [SW|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA], [protein|017A57F27DD8E515242FB658A61E74C1D58273CC|PfeT]
  • [SW|Domains]

  • HMA domain (aa 5-73) (according to UniProt)
  • Structure

  • [PDB|4BBJ] (CopA from ''Legionella pneumophila'', 32% identity, 67% similarity) [Pubmed|24317491]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12779235], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA]: repression, [Pubmed|15948947], in [regulon|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA regulon]
  • regulation

  • induced by toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|12779235,15948947]
  • view in new tab

    Biological materials


  • MGNA-A491 (yvgW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT, downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
  • BKK33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT, downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 15948947,12779235,24317491,11934502,25213752