SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cadmium transporting ATPase, resistance to cadmium
75.22 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
cadmium export
cadmium transporting ATPase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,438,853 3,440,952

    The protein

    Catalyzed reaction/ biological activity

  • ATP + Cd2+ + H2O --> ADP + Cd2+ + H+ + phosphate (according to UniProt)
  • ATP + H2O + Zn2+ --> ADP + H+ + phosphate + Zn2+ (according to UniProt)
  • Protein family

  • [SW|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA], [protein|017A57F27DD8E515242FB658A61E74C1D58273CC|PfeT]
  • [SW|Domains]

  • HMA domain (aa 5-73) (according to UniProt)
  • Structure

  • [PDB|4BBJ] (CopA from ''Legionella pneumophila'', 32% identity, 67% similarity) [Pubmed|24317491]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12779235], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA]: repression, [Pubmed|15948947], in [regulon|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA regulon]
  • regulation

  • induced by toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|12779235,15948947]
  • view in new tab

    Biological materials


  • MGNA-A491 (yvgW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT, downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
  • BKK33490 ([gene|5BC6B02770E74FF6D453742832574A87BB2369B8|cadA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAGTCTCACCTTACCTT, downstream forward: _UP4_TAAATTGTCGGAGAGAATTC
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 15948947,12779235,24317491,11934502,25213752