SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transpeptidase, penicillin-binding protein 3
74.23 kDa
protein length
668 aa Sequence Blast
gene length
2007 bp Sequence Blast
penicillin-binding protein 3

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    463,934 465,940

    Phenotypes of a mutant

  • increased sensitivity to several -lactams [pubmed|28792086]
  • The protein

    Catalyzed reaction/ biological activity

  • cross-linking of glycan chains [pubmed|28792086]
  • Protein family

  • [SW|transpeptidase family] (according to UniProt)
  • Structure

  • [PDB|5E31] (from Enterococcus faecium, 40% identity)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • mid cell localization (divisome), this depends on [protein|search|FtsZ ]and [protein|EBEFF9E0A524DCDA19382E5401B923B805E4C559|PBP2A ][pubmed|28792086]
  • extracellular (signal peptide) [Pubmed|18957862]
  • during vegetative growth: distinct foci and bands at cell periphery [pubmed|14731276]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE04140 ([gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTTTCCCCTGCCTTC, downstream forward: _UP4_TAAAATGTCTTTTTAAAAGG
  • BKK04140 ([gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTTTCCCCTGCCTTC, downstream forward: _UP4_TAAAATGTCTTTTTAAAAGG
  • GFP fusion

  • 3105 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]::pSG5045 (cat Pxyl-gfpa-[gene|5BBA2769A9C0EDB56625F008A55470C2E2885AA4|pbpC]1-768) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jeff Errington] lab
  • References

  • 8830698,14731276,20487272,18957862,28792086