SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component response regulator
22.18 kDa
protein length
200 aa Sequence Blast
gene length
603 bp Sequence Blast
two-component response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,495,876 3,496,478

    The protein

    Paralogous protein(s)

  • [protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-119) (according to UniProt)
  • [SW|HTH luxR-type domain] (aa 133-198) (according to UniProt)
  • Modification

  • phosphorylated on Arg-116 and Arg-143 (phosphorylation serves as tag for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]) [Pubmed|27749819]
  • phosphorylated by [protein|91110611D775A1746766D43BDF50F2F6D345B625|YvfT] on an Asp residue
  • Structure

  • [PDB|4LDZ] ([protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR], 59% identity) [pubmed|25406381]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials


  • MGNA-A496 (yvfU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34060 ([gene|5BB2B90D5DDD50DD9B4EF9E69925FCBFA642222B|yvfU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGAATCATTCTTTTCGTCC, downstream forward: _UP4_TAACCATATACTGCACTCCT
  • BKK34060 ([gene|5BB2B90D5DDD50DD9B4EF9E69925FCBFA642222B|yvfU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGAATCATTCTTTTCGTCC, downstream forward: _UP4_TAACCATATACTGCACTCCT
  • References

  • 10094672,27749819,25406381