SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


serine O-acetyltransferase
24.00 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
biosynthesis of cysteine
serine O-acetyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    112,800 113,453

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + L-serine --> CoA + O-acetyl-L-serine (according to UniProt)
  • Protein family

  • [SW|Transferase hexapeptide repeat family] (according to UniProt)
  • Structure

  • [PDB|1T3D] (from ''Escherichia coli'', 48% identity, 64% similarity) [Pubmed|15231846]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7510287], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: transcription antitermination, overlaps a transcription terminator upstream of [gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE], in [regulon|T-box|T-box]
  • regulation

  • expression transiently increases in the forespore [Pubmed|22848659]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE00930 ([gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGCTTCCCCCCGTTTC, downstream forward: _UP4_AGAAAAGAAAGGATCAATCA
  • BKK00930 ([gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGCTTCCCCCCGTTTC, downstream forward: _UP4_AGAAAAGAAAGGATCAATCA
  • References

  • 19258532,15231846,7510287,28189581