SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|MarR family|MarR/DUF24 family] transcription repressor of the [gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]-[gene|AA75013C05E1A88FC51410F9F1B30EE7D15F34C2|catE] operon
26.99 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
resistance against oxidative and electrophile stress
[SW|MarR family|MarR/DUF24 family] transcription repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,457,615 3,457,941

    Phenotypes of a mutant

  • increased resistance to catechol and quinones [Pubmed|20639328]
  • The protein

    Catalyzed reaction/ biological activity

  • [SW|MarR family|MarR/DUF24 family] transcription repressor of the [gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]-[gene|AA75013C05E1A88FC51410F9F1B30EE7D15F34C2|catE] operon [Pubmed|20639328]
  • Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]
  • Modification

  • in responsse to the presence of diamides or quinones, Cys-7 forms intermolecular disulfide bonds, this results in loss of DNA-bindig ability (induction of [gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]-[gene|AA75013C05E1A88FC51410F9F1B30EE7D15F34C2|catE]) [Pubmed|20639328]
  • Structure

  • [PDB|5HS7] ([protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB], 46% identity) [Pubmed|27531959]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A451 (yvaP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33680 ([gene|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|catR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTCACCTCGTCTG, downstream forward: _UP4_TAATTGCTAAAATGGTTCTG
  • BKK33680 ([gene|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|catR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTCACCTCGTCTG, downstream forward: _UP4_TAATTGCTAAAATGGTTCTG
  • labs

  • [SW|Haike Antelmann],University of Greifswald, Germany
  • References

  • 18282125,27531959