SubtiBank SubtiBank
nfrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nfrA

[protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]-dependent FMN-containing NADPH-linked nitro/flavin reductase, stress protein
locus
BSU_38110
pI
5.73
mw
28.17 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
function
unknown
product
FMN-containing NADPH-linked nitro/flavin reductase
essential
no
synonyms
ywcG,ipa-43d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,911,477 3,912,226

    The protein

    Catalyzed reaction/ biological activity

  • possesses an NADH oxidase activity that leads to high concentrations of oxygen peroxide and an NAD( ) degrading activity leading to free nicotinamide [Pubmed|20727352]
  • FMNH2 + NADP+ --> FMN + 2 H+ + NADPH (according to UniProt)
  • Protein family

  • flavin oxidoreductase frp family (with [protein|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|YcnD], according to UniProt)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|3N2S] [Pubmed|20727352]
  • Expression and Regulation

    Operons

    genes
    [gene|5B95F7CFEFCB954FCBC11087F030A1D777F34B7A|nfrA]-[gene|A1DCFF8D225C87197104742E72A0D4F238BC30EB|ywcH]
    description
    [Pubmed|10913069]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10913069], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9535080], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|29271514,12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • induced by cell wall stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|29271514]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B232 (ywcG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1231 NBRP B. subtilis, Japan]
  • BKE38110 ([gene|5B95F7CFEFCB954FCBC11087F030A1D777F34B7A|nfrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAAAAACCTCCTTAT, downstream forward: _UP4_TAAAGCAAACCTCTCCGTCT
  • BKK38110 ([gene|5B95F7CFEFCB954FCBC11087F030A1D777F34B7A|nfrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAAAAACCTCCTTAT, downstream forward: _UP4_TAAAGCAAACCTCTCCGTCT
  • References

  • 9535080,16847875,10913069,12642660,14651647,20727352,9836433,24847778,29271514