SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane protein, similar to coordinator of zonal elongation, may control [SW|cell wall synthesis ]by the [SW|penicillin-binding proteins]
43.45 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
may control [SW|cell wall synthesis ]by the [SW|penicillin-binding proteins]
similar to coordinator of zonal elongation

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,195,558 3,196,724

    The protein

    Protein family

  • [SW|autoinducer-2 exporter (AI-2E) (TC 2.A.86) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|42D1A2198CB4C738F5D4C6FA95B1BA24D5620F7E|YueF], [protein|561308269D6A42506DB61EA86ECD1F96E5886920|YrrI]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A223 (yubA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31160 ([gene|5B769207B05D93FEC36E97BB7074F29BB290C55A|yubA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCGTTCCTCCGTCAT, downstream forward: _UP4_TGATTTTCGTTTATAGTTAT
  • BKK31160 ([gene|5B769207B05D93FEC36E97BB7074F29BB290C55A|yubA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATCGTTCCTCCGTCAT, downstream forward: _UP4_TGATTTTCGTTTATAGTTAT
  • References

    Research papers

  • 27941863