SubtiBank SubtiBank
yjcN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcN

unknown
locus
BSU_11920
pI
8.39
mw
11.81 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,265,057 1,265,377

    Expression and Regulation

    Operons

    genes
    [gene|5B7495C7576235091ECA41ADA4F38A611F8E1618|yjcN]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok] [Pubmed|15743949]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B301 (yjcN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1300 NBRP B. subtilis, Japan]
  • BKE11920 ([gene|5B7495C7576235091ECA41ADA4F38A611F8E1618|yjcN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCGATACCT, downstream forward: _UP4_TAAAAATAAATTTTAAAATT
  • BKK11920 ([gene|5B7495C7576235091ECA41ADA4F38A611F8E1618|yjcN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCGATACCT, downstream forward: _UP4_TAAAAATAAATTTTAAAATT
  • References

  • 15743949