SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


11.81 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,265,057 1,265,377

    Expression and Regulation



    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok] [Pubmed|15743949]
  • view in new tab

    Biological materials


  • MGNA-B301 (yjcN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11920 ([gene|5B7495C7576235091ECA41ADA4F38A611F8E1618|yjcN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCGATACCT, downstream forward: _UP4_TAAAAATAAATTTTAAAATT
  • BKK11920 ([gene|5B7495C7576235091ECA41ADA4F38A611F8E1618|yjcN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCGATACCT, downstream forward: _UP4_TAAAAATAAATTTTAAAATT
  • References

  • 15743949