SubtiBank SubtiBank
ycbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycbD

NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase
locus
BSU02470
pI
4.79
mw
52.25 kDa
protein length
488 aa Sequence Blast
gene length
1467 bp Sequence Blast
function
utilization of D-glucarate/galactarate
product
NADP+-dependent alpha-ketoglutaric semialdehyde dehydrogenase
essential
no
ec
1.2.1.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.14|Utilization of glucarate/galactarate]
  • Gene

    Coordinates
    268,846 270,312

    The protein

    Catalyzed reaction/ biological activity

  • an aldehyde + NAD+ + H2O = an acid + NADH (according to Swiss-Prot)
  • Protein family

  • aldehyde dehydrogenase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC]
  • [SW|Cofactors]

  • NAD+
  • Structure

  • [PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 36% identity, 69% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
    description
    [Pubmed|12044674]

    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials

    Mutant

  • BKE02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG, downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC
  • BKK02470 ([gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCCATTGCCCCTTTCG, downstream forward: _UP4_TAATGGTGCTGGAAAGAGGC
  • References

  • 12044674,17202142