SubtiBank SubtiBank
yefC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yefC

similar to resolvase
locus
BSU_06750
pI
9.82
mw
13.94 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    739,878 740,213

    The protein

    Protein family

  • [SW|site-specific recombinase resolvase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Resolvase/invertase-type recombinase catalytic domain] (aa 1-56) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]-[gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]-[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|dnmA]-[gene|2E55D086DD5023B98929FB8B61238C00E66B8BCB|yeeB]-[gene|DB1AAC91947A6008F631266E5CC85B58703AFD9D|yeeC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A962 (yefC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/962 NBRP B. subtilis, Japan]
  • BKE06750 ([gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTTTGATGCAATAGCAA, downstream forward: _UP4_TAAATATTGTGAATTAATTA
  • BKK06750 ([gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGCTTTGATGCAATAGCAA, downstream forward: _UP4_TAAATATTGTGAATTAATTA