SubtiBank SubtiBank
parA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

parA

ATPase, centromere-like function involved in forespore chromosome partitioning / negative regulation of [category|SW 4.2|Sporulation] initiation
locus
BSU40970
pI
4.90
mw
27.39 kDa
protein length
253 aa Sequence Blast
gene length
759 bp Sequence Blast
function
forespore chromosome partitioning / negative regulation of [category|SW 4.2|Sporulation] initiation
product
negative regulator of [category|SW 4.2|Sporulation] initiation
essential
no
synonyms
soj,spo0JA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,206,397 → 4,207,158

    Phenotypes of a mutant

  • defective in oriC segregation during [category|SW 4.2|Sporulation] [pubmed|27489185]
  • The protein

    Catalyzed reaction/ biological activity

  • regulates [SW|DNA replication] initiation by either inhibiting or activating the [SW|DNA replication] initiator protein [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|21235642]; regulation of ''Spo0A'' expression [Pubmed|10852876]
  • Protein family

  • parA family (according to Swiss-Prot)
  • Effectors of protein activity

  • [protein|EF4BD49FCD49EE97908973581478951C8FA196C0|ParB] inhibits [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] dimerization and concomitant DNA-binding activity by stimulating [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] ATPase activity [Pubmed|21235642]
  • Structure

  • [PDB|5U1G] [pubmed|28373206]
  • [PDB|5U1J] [pubmed|28373206]
  • [SW|Localization]

  • polar/ septal at the cell membrane [Pubmed|20566861]
  • polar localization depends on the proton motive force [Pubmed|20566861]
  • Expression and Regulation

    Operons

    genes
    [gene|5B3DB5A796ACA48390278E60478DFF13D0074A8D|parA]-[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • BKE40970 (Δ[gene|5B3DB5A796ACA48390278E60478DFF13D0074A8D|parA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATGTCACCTACTTTCA, downstream forward: _UP4_GATTTAGCAAAGGAAGTGGC
  • BKK40970 (Δ[gene|5B3DB5A796ACA48390278E60478DFF13D0074A8D|parA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATGTCACCTACTTTCA, downstream forward: _UP4_GATTTAGCAAAGGAAGTGGC
  • Labs working on this gene/protein

  • [SW|Heath Murray], Centre for Bacterial Cell Biology, Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/heath.murray homepage]
  • References

    Reviews

  • 20157337,22934648,26286503,26706151,28075389
  • Original publications

  • 15659156,11532141,19450516,18854156,10619015,8866474,12492861,9701805,12950914,14651647,19450516,20566861,21235642,10852876,14563866,26253537,22286949,21911367,27059541,27489185,28373206,27489185