SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


methylthioadenosine nucleosidase
25.12 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
methionine salvage
methylthioadenosine nucleosidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    2,787,130 2,787,825

    The protein

    Catalyzed reaction/ biological activity

  • H2O + S-adenosyl-L-homocysteine --> adenine + S-(5-deoxy-D-ribos-5-yl)-L-homocysteine (according to UniProt)
  • H2O + S-methyl-5'-thioadenosine --> adenine + S-methyl-5-thio-D-ribose (according to UniProt)
  • Protein family

  • PNP/UDP phosphorylase family (with [protein|3075327DBE55C4F628171AEE248CAED5870693FA|DeoD], according to UniProt)
  • Structure

  • [PDB|1JYS] (from ''Escherichia coli'', 51% identity, 70% similarity) [Pubmed|11591349]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,16885442], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-A850 (yrrU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27270 ([gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCACATTCCCTTC, downstream forward: _UP4_TAAAACGGGGAGAACGTTCT
  • BKK27270 ([gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCACATTCCCTTC, downstream forward: _UP4_TAAAACGGGGAGAACGTTCT
  • References

  • 17056751,16513748,12642660,15102328,16885442,24509311