SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


anti-[SW|sigma factor] to [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB], protein serine kinase, phosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV]
17.85 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
control of [protein|search|SigB ]activity
anti-[SW|sigma factor], protein serine kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    522,414 522,896

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV]
  • negative regulator (by binding) of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]
  • ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
  • ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
  • Protein family

  • anti-sigma-factor family (with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], according to UniProt)
  • Structure

  • [PDB|1TIL] ([protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], 32% identity) [pubmed|15236958]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab



  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE04720 ([gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGATGTAATCAGCATTAT, downstream forward: _UP4_TATTTAAATGGGGAGCGAGT
  • BKK04720 ([gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGATGTAATCAGCATTAT, downstream forward: _UP4_TATTTAAATGGGGAGCGAGT
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [ homepage]
  • References

  • 8682789,8144446,8002610,8682769,11591687,8955331,8460143,8808936,8824586,8764398,7601843,15342585,12270815,23524614,11544224,23407164,21979936,25278935,27977677,15236958