SubtiBank SubtiBank
rsbW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rsbW

anti-[SW|sigma factor] to [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB], protein serine kinase, phosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV]
locus
BSU04720
pI
4.28
mw
17.85 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
control of [protein|search|SigB ]activity
product
anti-[SW|sigma factor], protein serine kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    522,414 522,896

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV]
  • negative regulator (by binding) of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]
  • Protein family

  • anti-sigma-factor family (according to Swiss-Prot)
  • Structure

  • [PDB|1TIL] ([protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], 32% identity) [pubmed|15236958]
  • Expression and Regulation

    Operons

    genes
    [gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|8002610]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|2170324]

    regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE04720 ([gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGATGTAATCAGCATTAT, downstream forward: _UP4_TATTTAAATGGGGAGCGAGT
  • BKK04720 ([gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGATGTAATCAGCATTAT, downstream forward: _UP4_TATTTAAATGGGGAGCGAGT
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

  • 8682789,8144446,8002610,8682769,11591687,8955331,8460143,8808936,8824586,8764398,7601843,15342585,12270815,23524614,11544224,23407164,21979936,25278935,27977677,15236958