SubtiBank SubtiBank
yraO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yraO

citrate uptake via proton symport
locus
BSU_26860
pI
9.32
mw
46.56 kDa
protein length
438 aa Sequence Blast
gene length
1317 bp Sequence Blast
function
citrate uptake
product
citrate uptake via proton symport
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,744,163 2,745,479

    The protein

    Protein family

  • [SW|CitM transporter family (TC 2.A.11)] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AD1C6BA47924F07974680E1E5591DD96BA95A98A|yraN]-[gene|5AE18B11C9E13E5B121673955E01F1B1E8DB1637|yraO]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A234 (yraO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/234 NBRP B. subtilis, Japan]
  • BKE26860 ([gene|5AE18B11C9E13E5B121673955E01F1B1E8DB1637|yraO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACACCTCCAAGAAT, downstream forward: _UP4_TAAAGAAACAATAATAATAT
  • BKK26860 ([gene|5AE18B11C9E13E5B121673955E01F1B1E8DB1637|yraO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACACCTCCAAGAAT, downstream forward: _UP4_TAAAGAAACAATAATAATAT
  • References

  • 22383849