SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


citrate uptake via proton symport
46.56 kDa
protein length
438 aa Sequence Blast
gene length
1317 bp Sequence Blast
citrate uptake
citrate uptake via proton symport

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,744,163 2,745,479

    The protein

    Protein family

  • [SW|CitM transporter family (TC 2.A.11)] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A234 (yraO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26860 ([gene|5AE18B11C9E13E5B121673955E01F1B1E8DB1637|yraO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACACCTCCAAGAAT, downstream forward: _UP4_TAAAGAAACAATAATAATAT
  • BKK26860 ([gene|5AE18B11C9E13E5B121673955E01F1B1E8DB1637|yraO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACACCTCCAAGAAT, downstream forward: _UP4_TAAAGAAACAATAATAATAT
  • References

  • 22383849