SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


PBSX prophage
18.12 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,331,245 1,331,730

    Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12630 ([gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCTGTTTCAATCCCGCTA, downstream forward: _UP4_AAGAAGCTGTAAAGGAGGAG
  • BKK12630 ([gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCTGTTTCAATCCCGCTA, downstream forward: _UP4_AAGAAGCTGTAAAGGAGGAG
  • References

  • 2110147,8083174,27766092