SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


sulfite reductase (NADPH2) (alpha subunit)
67.08 kDa
protein length
605 aa Sequence Blast
gene length
1818 bp Sequence Blast
sulfite reduction
sulfite reductase (NADPH2)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • Gene

    3,432,339 3,434,156

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • The protein

    Catalyzed reaction/ biological activity

  • 3 H2O + hydrogen sulfide + 3 NADP+ --> 4 H+ + 3 NADPH + sulfite (according to UniProt)
  • [SW|Cofactors]

  • FMN [Pubmed|21635694]
  • FAD [Pubmed|21635694]
  • Structure

  • [PDB|5GXU] (from Arabidopsis, 32% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: activation, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • induced by sulfite, sulfate, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials


  • 1A802 ( ''cysJ''::''kan''), [Pubmed|11445163], available at [ BGSC]
  • 1A934 ( ''cysJ''::''kan''), [Pubmed|12169591], available at [ BGSC]
  • BKE33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
  • BKK33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
  • References

  • 15378759,12169591,12107147,11445163,25875741