SubtiBank SubtiBank
cysJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cysJ

sulfite reductase (NADPH2) (alpha subunit)
locus
BSU33440
pI
4.57
mw
67.08 kDa
protein length
605 aa Sequence Blast
gene length
1818 bp Sequence Blast
function
sulfite reduction
product
sulfite reductase (NADPH2)
essential
no
synonyms
yvgQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • Gene

    Coordinates
    3,432,339 3,434,156

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • The protein

    [SW|Cofactors]

  • FMN [Pubmed|21635694]
  • FAD [Pubmed|21635694]
  • Structure

  • [PDB|5GXU] (from Arabidopsis, 32% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]-[gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]
    description
    [Pubmed|12169591]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: activation, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • induced by sulfite, sulfate, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials

    Mutant

  • 1A802 ( ''cysJ''::''kan''), [Pubmed|11445163], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A802&Search=1A802 BGSC]
  • 1A934 ( ''cysJ''::''kan''), [Pubmed|12169591], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A934&Search=1A934 BGSC]
  • BKE33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
  • BKK33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
  • References

  • 15378759,12169591,12107147,11445163,25875741