SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin]
17.17 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins/ based on similarity]
  • Gene

    3,609,420 3,609,902

    Phenotypes of a mutant

  • No swarming motility on B medium. [Pubmed|19202088]
  • The protein

    Protein family

  • bacterial flagellin family (with [protein|82AB04023BCB57967C7501E6AEAC4BB593AA6480|FlgL] and [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|Hag], according to UniProt)
  • Paralogous protein(s)

  • [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|Hag]:
  • Structure

  • [PDB|6GOW] (the [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin]-[protein|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|FliS] complex, 66% identity) [pubmed|30068950]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B647 (yvzB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35150 ([gene|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|yvzB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCTTTAATTGCAC, downstream forward: _UP4_TAATTTTGAACGGCTATCTC
  • BKK35150 ([gene|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|yvzB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCTTTAATTGCAC, downstream forward: _UP4_TAATTTTGAACGGCTATCTC
  • References

  • 19202088,15033535,30068950