SubtiBank SubtiBank
aadK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aadK

aminoglycoside 6-adenylyltransferase
locus
BSU_26790
pI
4.76
mw
33.75 kDa
protein length
284 aa Sequence Blast
gene length
855 bp Sequence Blast
function
resistance to streptomycin
product
aminoglycoside 6-adenylyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    2,735,682 2,736,536

    The protein

    Structure

  • [PDB|2PBE]
  • Expression and Regulation

    Operons

    genes
    [gene|5A867E29385030DBA3871C39405C89C623F9399F|aadK]-[gene|E02EB2B08203501E6DD2D1FB24BDA59058F87FB9|bstE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26790 ([gene|5A867E29385030DBA3871C39405C89C623F9399F|aadK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACATGTTCCTCCGTTT, downstream forward: _UP4_TGATAAGAATATAGGATTGT
  • BKK26790 ([gene|5A867E29385030DBA3871C39405C89C623F9399F|aadK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACATGTTCCTCCGTTT, downstream forward: _UP4_TGATAAGAATATAGGATTGT
  • References

  • 2550327,8293959