SubtiBank SubtiBank
pxpB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pxpB

subunit of ATP-dependent 5-oxoprolinase, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA], control of the [SW|phosphorelay]
locus
BSU_04080
pI
4.66
mw
26.57 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
function
detoxification of 5-oxoproline, control of the [SW|phosphorelay], initiation of [SW|sporulation]
product
subunit of 5-oxoprolinase, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA]
essential
no
synonyms
kipI,ycsJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.2|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.2|Proteins controlling the activity of the kinases]
  • Gene

    Coordinates
    459,867 460,589

    Phenotypes of a mutant

  • no growth with 5-oxoproline as single source of nitrogen [pubmed|28830929]
  • reduced growth with ammonium as source of nitrogen due to the accumulation of toxic 5-oxoproline [pubmed|28830929]
  • The protein

    Catalyzed reaction/ biological activity

  • 5-oxoproline + ATP --> glutamate + ADP + Pi [pubmed|28830929]
  • Protein family

  • PxpB family (single member, according to UniProt)
  • Kinetic information

  • Km (5-oxoproline): 39 M [pubmed|28830929]
  • Effectors of protein activity

  • binding of [protein|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|PxpC] prevents [protein|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|PxpB] from binding to [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] [Pubmed|9334321]
  • Structure

  • [PDB|2ZP2] [Pubmed|18823995]
  • Expression and Regulation

    Operons

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • BKE04080 ([gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG
  • BKK04080 ([gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG
  • References

  • 9334321,20524093,18823995,21050859,25755103,28830929