SubtiBank SubtiBank
pxpB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pxpB

subunit of ATP-dependent 5-oxoprolinase, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA], control of the [SW|phosphorelay]
locus
BSU_04080
pI
4.66
mw
26.57 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
function
detoxification of 5-oxoproline, control of the [SW|phosphorelay], initiation of [SW|sporulation]
product
subunit of 5-oxoprolinase, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA]
essential
no
synonyms
kipI,ycsJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.2|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.2|Proteins controlling the activity of the kinases]
  • Gene

    Coordinates
    459,867 460,589

    Phenotypes of a mutant

  • no growth with 5-oxoproline as single source of nitrogen [pubmed|28830929]
  • reduced growth with ammonium as source of nitrogen due to the accumulation of toxic 5-oxoproline [pubmed|28830929]
  • The protein

    Catalyzed reaction/ biological activity

  • 5-oxoproline + ATP --> glutamate + ADP + Pi [pubmed|28830929]
  • Protein family

  • PxpB family (single member, according to UniProt)
  • Kinetic information

  • Km (5-oxoproline): 39 M [pubmed|28830929]
  • Effectors of protein activity

  • binding of [protein|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|PxpC] prevents [protein|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|PxpB] from binding to [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] [Pubmed|9334321]
  • Structure

  • [PDB|2ZP2] [Pubmed|18823995]
  • Expression and Regulation

    Operons

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • BKE04080 ([gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG
  • BKK04080 ([gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG
  • References

  • 9334321,20524093,18823995,21050859,25755103,28830929