SubtiBank SubtiBank
yxaC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxaC

holin-like auxilary protein
locus
BSU_40022
pI
9.00
mw
25.00 kDa
protein length
230 aa Sequence Blast
gene length
693 bp Sequence Blast
function
unknown
product
holin-like auxilary protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,110,217 4,110,909

    Phenotypes of a mutant

  • a ''[gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC]'' mutant is delayed in pellicle formation [Pubmed|26060272]
  • a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] [gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC] [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' triple mutant is severely delayed in pellicle formation [Pubmed|26060272]
  • The protein

    Protein family

  • YohK (E.coli)/YwbG (IPA-22R) (B.subtilis) family (with [protein|2940E73F0BCAB69992BBD224402C95C2667757AD|YwbG], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B682 (yxaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1681 NBRP B. subtilis, Japan]
  • BKE40022 ([gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40022 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAAGCGGCAACTGTTAAAA, downstream forward: _UP4_TAACAAAGAAAGACTGCCCC
  • BKK40022 ([gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40022 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAAGCGGCAACTGTTAAAA, downstream forward: _UP4_TAACAAAGAAAGACTGCCCC
  • References

  • 26060272,10746760