SubtiBank SubtiBank
nucB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nucB

[SW|sporulation]-specific extracellular nuclease
locus
BSU_25750
pI
5.17
mw
14.83 kDa
protein length
136 aa Sequence Blast
gene length
411 bp Sequence Blast
function
DNA degradation after mother cell lysis
product
[SW|sporulation]-specific extracellular nuclease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,652,387 2,652,797

    The protein

    Structure

  • [PDB|5OMT] ([protein|search|NucB ]from B. licheniformis, 77% identity, aa 27 - 136) [pubmed|29165717]
  • [SW|Localization]

  • extracellular(signal peptide)(according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]
    description
    [Pubmed|7746143]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7746143], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|7746143]
  • view in new tab

    Biological materials

    Mutant

  • BKE25750 ([gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCATCCCCCCATACC, downstream forward: _UP4_TAGTAAAGAAGAGGCTCTTT
  • BKK25750 ([gene|5A3CEDBF81E3263FDB10AC9245D28498C9332D14|nucB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCATCCCCCCATACC, downstream forward: _UP4_TAGTAAAGAAGAGGCTCTTT
  • References

  • 17209033,7746143,29165717