SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


coproporphyrinogen III oxidase
57.00 kDa
protein length
501 aa Sequence Blast
gene length
1506 bp Sequence Blast
heme biosynthesis
coproporphyrinogen III oxidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of heme/ siroheme]
  • Gene

    1,057,680 1,059,185

    The protein

    Protein family

  • anaerobic coproporphyrinogen-III oxidase family (with [protein|757C51296E198849EAC1FFA4D37121D9085930A8|HemN], according to UniProt)
  • Paralogous protein(s)

  • [protein|757C51296E198849EAC1FFA4D37121D9085930A8|HemN]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10498703], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • regulation

  • induced under anaerobic conditions during growth in the presence of nitrate (no induction in the absence of terminal electron acceptor) ([protein|search|Fnr], [protein|search|ResD], [protein|search|ArfM]) [Pubmed|10498703]
  • view in new tab

    Biological materials


  • MGNA-B497 (yhaV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09840 ([gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCATCACCTAATTTA, downstream forward: _UP4_CACTGATTACAGTGCTGCTT
  • BKK09840 ([gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCATCACCTAATTTA, downstream forward: _UP4_CACTGATTACAGTGCTGCTT
  • References

  • 10498703