SubtiBank SubtiBank
yobM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobM

unknown
locus
BSU_19010
pI
4.07
mw
19.00 kDa
protein length
187 aa Sequence Blast
gene length
565 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • The protein

    Paralogous protein(s)

  • [protein|9D3C94ED5DF019669EE9BB0F9A5D5976C42BFEB3|YokH]
  • Biological materials

    Mutant

  • MGNA-A310 (yobM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/310 NBRP B. subtilis, Japan]
  • BKE19010 ([gene|59FB4B286B814797FC2A3C0B42E1475364141A87|yobM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATACATCACCCCTTTAT, downstream forward: _UP4_TAGTGTGTGATGTATAAGAC
  • BKK19010 ([gene|59FB4B286B814797FC2A3C0B42E1475364141A87|yobM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATACATCACCCCTTTAT, downstream forward: _UP4_TAGTGTGTGATGTATAAGAC