SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat protein, similar to manganese-containing catalase
31.15 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
protection of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class V]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.9|Resistance against oxidative and electrophile stress/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,319,690 1,320,526

    The protein

    Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8F21A4C6228A772B38597991AF43E6B0708339BF|CotJC], [protein|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|YdbD]
  • Structure

  • [PDB|1JKU] (from Lactobacillus plantarum, 49% identity) [pubmed|11587647]
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|20451384,22171814]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [pubmed|26577401], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK])
  • view in new tab

    Biological materials


  • MGNA-B306 (yjqC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12490 ([gene|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCCCAC, downstream forward: _UP4_TAGGTTCTCTTCTGGGCTGA
  • BKK12490 ([gene|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCCCAC, downstream forward: _UP4_TAGGTTCTCTTCTGGGCTGA
  • References

  • 20451384,22171814,15383836,11587647,26577401