SubtiBank SubtiBank
yjqC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjqC

spore coat protein, similar to manganese-containing catalase
locus
BSU_12490
pI
5.15
mw
31.15 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.9|Resistance against oxidative and electrophile stress/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    Coordinates
    1,319,690 1,320,526

    The protein

    Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8F21A4C6228A772B38597991AF43E6B0708339BF|CotJC], [protein|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|YdbD]
  • Structure

  • [PDB|1JKU] (from Lactobacillus plantarum, 49% identity) [pubmed|11587647]
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|20451384,22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|BA7D1D112E934B68073DFC1F76248ED6157240E3|pghB]-[gene|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [pubmed|26577401], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK])
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B306 (yjqC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1305 NBRP B. subtilis, Japan]
  • BKE12490 ([gene|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCCCAC, downstream forward: _UP4_TAGGTTCTCTTCTGGGCTGA
  • BKK12490 ([gene|59EC45E8731FE989152553A69ACEF6569E88F85C|yjqC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCATTCCTCCCCAC, downstream forward: _UP4_TAGGTTCTCTTCTGGGCTGA
  • References

  • 20451384,22171814,15383836,11587647,26577401