SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|ABC transporter] (ATP-binding protein), mutation affects proteolysis by [protein|CB50289535EA537F63BADD459BD11AA7759A6658|RasP] (no processing of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] and [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL])
27.57 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
regulation of the secretion apparatus and of intra-membrane proteolysis
[SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Regulatory ABC transporters]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,077,440 1,078,183

    Phenotypes of a mutant

  • no processing of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] and [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL] [Pubmed|18599827]
  • inactivation of ''[gene|59A7B26F810D7FEB07C176A8B2ECF6B83803DE49|ecsA]'' reduces sporulation efficiency to 0.1% that of wild type cells [Pubmed|26735940]
  • The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|47C1A154AF6F67CA507A9F4FEA9576E7131EFB6D|YthP]
  • Structure

  • [PDB|4RVC] (from Geobacillus kaustophilus, 71% identity) [pubmed|25724946]
  • [SW|Localization]

  • membrane associated (via [protein|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|EcsB]) [Pubmed|10092453]
  • Expression and Regulation


    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • BKE10040 ([gene|59A7B26F810D7FEB07C176A8B2ECF6B83803DE49|ecsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCCCCTTATAG, downstream forward: _UP4_GAGCTTACAAAGGAAGACGC
  • BKK10040 ([gene|59A7B26F810D7FEB07C176A8B2ECF6B83803DE49|ecsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCCCCTTATAG, downstream forward: _UP4_GAGCTTACAAAGGAAGACGC
  • References


  • 29343670
  • Original publications

  • 8581172,12884008,10092453,18599827,10027970,26735940,25724946