SubtiBank SubtiBank
opuD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

opuD

glycine betaine and arsenobetaine transporter
locus
BSU_30070
pI
9.51
mw
55.95 kDa
protein length
512 aa Sequence Blast
gene length
1539 bp Sequence Blast
function
compatible solute transport
product
glycine betaine transporter
essential
no
synonyms
ytfQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.9|Uptake of compatible solutes]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,076,818 3,078,356

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine and arsenobetaine [pubmed|29159878]
  • Protein family

  • BCCT transporter (TC 2.A.15) family (single member, according to UniProt)
  • Structure

  • [PDB|4AIN] (BetP from Corynebacterium glutamicum, 44% identity) [pubmed|22940865]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|86274AAF9E0D0882F1AD9D4A528BECB013B71C38|ytfP]-[gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21296969], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|21296969], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by cold stress [Pubmed|21296969]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A815 (opuD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/815 NBRP B. subtilis, Japan]
  • 1A1052 ( ''opuD''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1052&Search=1A1052 BGSC]
  • 1A1053 ( ''opuD''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1053&Search=1A1053 BGSC]
  • 1A1054 ( ''opuD''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1054&Search=1A1054 BGSC]
  • 1A1055 ( ''opuD''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1055&Search=1A1055 BGSC]
  • BKE30070 ([gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACCCTCTAATTT, downstream forward: _UP4_TAACAAAAAAGATCTTTCCG
  • BKK30070 ([gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACCCTCTAATTT, downstream forward: _UP4_TAACAAAAAAGATCTTTCCG
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

    Reviews

  • 27935846
  • Original publications

  • 8752321,21296969,8752321,29159878,22940865