SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glycine betaine and arsenobetaine transporter
55.95 kDa
protein length
512 aa Sequence Blast
gene length
1539 bp Sequence Blast
compatible solute transport
glycine betaine transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Uptake of compatible solutes]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,076,818 3,078,356

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glycine betaine and arsenobetaine [pubmed|29159878]
  • Protein family

  • BCCT superfamily of transporters
  • Structure

  • [PDB|4AIN] (BetP from Corynebacterium glutamicum, 44% identity) [pubmed|22940865]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21296969], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|21296969], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by cold stress [Pubmed|21296969]
  • view in new tab

    Biological materials


  • MGNA-A815 (opuD::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A1052 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • 1A1053 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • 1A1054 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • 1A1055 ( ''opuD''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • BKE30070 ([gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACCCTCTAATTT, downstream forward: _UP4_TAACAAAAAAGATCTTTCCG
  • BKK30070 ([gene|597B517CA4277E33153F80919213BFF7BE495563|opuD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACCCTCTAATTT, downstream forward: _UP4_TAACAAAAAAGATCTTTCCG
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References


  • 27935846
  • Original publications

  • 8752321,21296969,8752321,29159878,22940865