SubtiBank SubtiBank
phoD [2019-07-22 10:01:58]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

phoD [2019-07-22 10:01:58]

phosphodiesterase/alkaline phosphatase, degrades wall teichoic acid during phosphate starvation
62.66 kDa
protein length
583 aa Sequence Blast
gene length
1752 bp Sequence Blast
aquisition of phosphate upon phosphoate starvation, degradation of wall teichoic acid during phosphate starvation
phosphodiesterase/alkaline phosphatase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    284,011 285,762

    The protein

    Catalyzed reaction/ biological activity

  • endohydrolytic activity on wall teichoic acid, acts in concert with [protein|E9BEF368F8E55888AD4849E8906E517831A882DF|GlpQ] [Pubmed|27780866]
  • A phosphate monoester + H2O = an alcohol + phosphate (according to Swiss-Prot)
  • Protein family

  • PhoD family (single member, according to UniProt)
  • [SW|Cofactors]

  • one Fe3+ and two Ca2+ [Pubmed|25217636]
  • Structure

  • [PDB|2YEQ] [Pubmed|25217636]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], secreted by the [protein|E4395255CD43ACB611E0BA872182DF801662C366|TatAD]-[protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|TatCD] complex [Pubmed|19395490]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10094677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10094677,11007775], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|10094677]
  • additional information

  • expression of the operon depends on functional [protein|search|HemAT] and [protein|search|CsbC] [PubMed|23180473]
  • view in new tab

    Biological materials


  • BKE02620 ([gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGATCCCCTCTCTC, downstream forward: _UP4_ATCACGAATTAAGGAGTGGA
  • BKK02620 ([gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGATCCCCTCTCTC, downstream forward: _UP4_ATCACGAATTAAGGAGTGGA
  • labs

  • [SW|Oscar Kuipers], University of Groningen, The Netherlands
  • [ Homepage]
  • References


  • 24140208
  • Original publications

  • 8760916,10913081,12867413,10094677,12218047,10556724,19180538,10094677,18957862,19383693,19395490,22960285,22383849,23180473,25217636,25666134,27118079,27780866