SubtiBank SubtiBank
phoD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phoD

phosphodiesterase/alkaline phosphatase, degrades wall teichoic acid during phosphate starvation
locus
BSU_02620
pI
8.39
mw
62.66 kDa
protein length
583 aa Sequence Blast
gene length
1752 bp Sequence Blast
function
aquisition of phosphate upon phosphoate starvation, degradation of wall teichoic acid during phosphate starvation
product
phosphodiesterase/alkaline phosphatase
essential
no
ec
3.1.3.1
synonyms
ycbS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    284,011 285,762

    The protein

    Catalyzed reaction/ biological activity

  • endohydrolytic activity on wall teichoic acid, acts in concert with [protein|E9BEF368F8E55888AD4849E8906E517831A882DF|GlpQ] [Pubmed|27780866]
  • phosphate monoester + H2O --> alcohol + phosphate (according to UniProt)
  • Protein family

  • PhoD family (single member, according to UniProt)
  • [SW|Cofactors]

  • one Fe3+ and two Ca2+ [Pubmed|25217636]
  • Structure

  • [PDB|2YEQ] [Pubmed|25217636]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], secreted by the [protein|E4395255CD43ACB611E0BA872182DF801662C366|TatAD]-[protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|TatCD] complex [Pubmed|19395490]
  • Expression and Regulation

    Operons

    genes
    [gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]-[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10094677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10094677,11007775], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|10094677]
  • additional information

  • expression of the operon depends on functional [protein|search|HemAT] and [protein|search|CsbC] [PubMed|23180473]
  • view in new tab

    Biological materials

    Mutant

  • BKE02620 ([gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGATCCCCTCTCTC, downstream forward: _UP4_ATCACGAATTAAGGAGTGGA
  • BKK02620 ([gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGATCCCCTCTCTC, downstream forward: _UP4_ATCACGAATTAAGGAGTGGA
  • labs

  • [SW|Oscar Kuipers], University of Groningen, The Netherlands
  • [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 24140208
  • Original publications

  • 8760916,10913081,12867413,10094677,12218047,10556724,19180538,10094677,18957862,19383693,19395490,22960285,22383849,23180473,25217636,25666134,27118079,27780866