SubtiBank SubtiBank
ytpB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytpB

tetraprenyl-beta-curcumene synthase, catalyzes the first committed step in C35 terpenoid biosynthesis, salt stress protein
locus
BSU_30500
pI
5.76
mw
42.68 kDa
protein length
367 aa Sequence Blast
gene length
1104 bp Sequence Blast
function
C35 terpenoid biosynthesis
product
tetraprenyl-beta-curcumene synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,121,538 3,122,641

    Phenotypes of a mutant

  • increased sensitivity to bacitracin, due to the accumulation of heptaprenyl pyrophosphate [Pubmed|24806199]
  • sensitivity is increased in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB] [gene|34DBBDD76A0B36867E5116FF17391DF70062F745|menA]'' double mutant [Pubmed|24806199]
  • The protein

    Catalyzed reaction/ biological activity

  • all-trans-heptaprenyl diphosphate --> diphosphate + tetraprenyl-β-curcumene (according to UniProt)
  • Structure

  • [PDB|5YO8] (from Bacillus alcalophilus, 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • expressed under conditions of salt stress ([protein|search|SigM]) [http://www.ncbi.nlm.nih.gov/sites/entrez/18179421 Pubmed]
  • view in new tab

    genes
    [gene|85A653AF4752A61A39F9C42FC791B2D1444886B1|ytpA]-[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • expressed under conditions of salt stress ([protein|search|SigM]) [http://www.ncbi.nlm.nih.gov/sites/entrez/18179421 Pubmed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A164 (ytpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/164 NBRP B. subtilis, Japan]
  • BKE30500 ([gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACATGCACCCCCTACT, downstream forward: _UP4_AAAAATTCAAAGAAAAAAGC
  • BKK30500 ([gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACATGCACCCCCTACT, downstream forward: _UP4_AAAAATTCAAAGAAAAAAGC
  • References

  • 9387221,18179421,23748782,21627333,24806199