SubtiBank SubtiBank
fabL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fabL

enoyl-acyl carrier protein reductase
locus
BSU_08650
pI
5.97
mw
27.03 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
fatty acid biosynthesis
product
enoyl-acyl carrier protein reductase
essential
no
synonyms
yfhR,ygaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.1|Biosynthesis of fatty acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    937,079 937,831

    The protein

    Catalyzed reaction/ biological activity

  • 2,3-saturated acyl-[ACP] + NADP+ --> (2E)-enoyl-[ACP] + H+ + NADPH (according to UniProt)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|60A519E4C1485B9F5BF36E83EDE884B396857CB4|FabI]:
  • [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF]:
  • [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF]:
  • [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO]:
  • Structure

  • [PDB|3OIC] [Pubmed|21185310]
  • Expression and Regulation

    Operons

    genes
    [gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]
    description
    [Pubmed|10463184]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10463184], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • [protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP]: repression, in [regulon|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    genes
    [gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]-[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]
    description
    [Pubmed|10463184]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10463184], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1900507], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP]: repression, in [regulon|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|YfhP regulon]
  • regulation

  • expression is constitutive throughout growth [Pubmed|20971907]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C324 (yfhR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2322 NBRP B. subtilis, Japan]
  • BKE08650 ([gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCTCATCTCCTTG, downstream forward: _UP4_TAAAAATTTTTAAAAAAGAG
  • BKK08650 ([gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCTCATCTCCTTG, downstream forward: _UP4_TAAAAATTTTTAAAAAAGAG
  • References

    Reviews

  • 15952903,17919287
  • Original Publications

  • 17114254,10463184,15699190,8755877,11007778,21185310,25527535